View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4254-Insertion-2 (Length: 170)
Name: NF4254-Insertion-2
Description: NF4254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4254-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 12 - 170
Target Start/End: Complemental strand, 47604626 - 47604468
Alignment:
| Q |
12 |
aacagtgcactctttatctgtggacagtctttgagttgcgtttccaacgcatgatgtgcatagattagaggggatgtcacctctgcacatatatagtcca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47604626 |
aacagtgcactctttatctgtggacagtctttgagttgcgtttccaacgcatgatgtgcatagattagaggggatgtcaactctgcacatatatagtcca |
47604527 |
T |
|
| Q |
112 |
taaacggtttctgaatgattttttccggcgacggtgttgttgaagaattggatgttttg |
170 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47604526 |
taaactgtttctgaatgattttttccggcgacggtgttgttgaagaattggatgttttg |
47604468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University