View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4254-Insertion-4 (Length: 115)
Name: NF4254-Insertion-4
Description: NF4254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4254-Insertion-4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 30757558 - 30757444
Alignment:
| Q |
1 |
tgtgaatgaagagcatatccctgccacaatttcattcggtactgatgacacttcaaatattcaggaaaagcttcatggtgagctgattaataccgaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757558 |
tgtgaatgaagagcatatccctgccacaatttcattcggtactgatgacacttcaaatattcaggaaaagcttcatggtgagctgattaataccgaagag |
30757459 |
T |
 |
| Q |
101 |
ctcattgttgctaat |
115 |
Q |
| |
|
||||| ||| ||||| |
|
|
| T |
30757458 |
ctcatcgttactaat |
30757444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University