View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4254_high_11 (Length: 310)
Name: NF4254_high_11
Description: NF4254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4254_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 108 - 240
Target Start/End: Complemental strand, 39077473 - 39077338
Alignment:
| Q |
108 |
agcaattaaaatcagaaaactaatcatctttgaatatagtcccaatagaacacaaccagcaaaacaatcacctagccatgtccaaagtctaattctatta |
207 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39077473 |
agcaattaaaatcagaaaactaaccatctttaaatatagtcccaatagaacacaaccagcaaaacaatcaccaagccatgtccaaattctaattctatta |
39077374 |
T |
|
| Q |
208 |
cagtcaa---atcaacatagtaatttcataaaatac |
240 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39077373 |
cagtcaaatcatcaacaaagtaatttcataaaatac |
39077338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 39077611 - 39077508
Alignment:
| Q |
1 |
attttaaacatgattaaaccatgcacatagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaatt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39077611 |
attttaaacatgattaaacca----catagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaagt |
39077516 |
T |
|
| Q |
101 |
ccatatca |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
39077515 |
ccatatca |
39077508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 236 - 299
Target Start/End: Complemental strand, 39072574 - 39072511
Alignment:
| Q |
236 |
aatactacatcaaatgtcatttacaaagaggtattccgcaatttgtaatgagtcctgctctctg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39072574 |
aatactacatcaaatgtcatttacaaagaggtattccgcaatttgtaatgagtcctgctgtctg |
39072511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 2317406 - 2317303
Alignment:
| Q |
1 |
attttaaacatgattaaaccatgcacatagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaatt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317406 |
attttaaacatgattaaacca----catagaagatatgaagttttcttagttaagaaattgttccagattgaatcttaggcaatgtgcatatctccaatt |
2317311 |
T |
|
| Q |
101 |
ccatatca |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
2317310 |
ccatatca |
2317303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University