View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4255-Insertion-3 (Length: 41)
Name: NF4255-Insertion-3
Description: NF4255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4255-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.00000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.00000000004
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 46975045 - 46975078
Alignment:
| Q |
5 |
agacatggtatgaccatcatggctgactgctttg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46975045 |
agacatggtatgaccatcatggctgactgctttg |
46975078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.000000009
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 46981032 - 46981065
Alignment:
| Q |
5 |
agacatggtatgaccatcatggctgactgctttg |
38 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
46981032 |
agacatggtatgaccatcatggttgactgctttg |
46981065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University