View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4255_high_10 (Length: 285)
Name: NF4255_high_10
Description: NF4255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4255_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 18 - 142
Target Start/End: Original strand, 2005344 - 2005477
Alignment:
| Q |
18 |
gaaactacgatccgtagcttcatatggtgatttctctaagtcttcttctgtgtaatgttttaattttaacatgca---------ttcaatgaatcttatt |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2005344 |
gaaactacgatccgtagcttgatatggtgatttctctaagtcttcttctgtgtaatgttttaattttaacatgcattcaatgagttcaatgaatcttatt |
2005443 |
T |
|
| Q |
109 |
gtagatcagtacatggtttaggagaaaaatgcag |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2005444 |
gtagatcagtacatggtttaggagaaaaatgcag |
2005477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 2018771 - 2018831
Alignment:
| Q |
20 |
aactacgatccgtagcttcatatggtgatttctctaagtcttcttctgtgtaatgttttaa |
80 |
Q |
| |
|
|||||||||| ||||||| | ||||||| |||| | |||||| |||||||||||||||||| |
|
|
| T |
2018771 |
aactacgatcggtagcttgacatggtgacttctgttagtcttattctgtgtaatgttttaa |
2018831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University