View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4255_high_14 (Length: 235)
Name: NF4255_high_14
Description: NF4255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4255_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 14 - 159
Target Start/End: Complemental strand, 52649892 - 52649742
Alignment:
| Q |
14 |
cttttcctcttccatctttctttccctgattcagaattaannnnnnnnnnngttt-----aaattgattgagaaaatttcttggattgtgannnnnnnat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
52649892 |
cttttcctcttccatctttctttccctgattcagaattaacttttttttttttttttttgaaattgattgagaaaatttcttggattgtgatttttttat |
52649793 |
T |
 |
| Q |
109 |
tattagaaattagaaattaataataaagaagatgaaaacaatttcactaga |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52649792 |
tattagaaattagaaattaataataaagaagatgaaaacaatttcactaga |
52649742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University