View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4255_low_14 (Length: 250)
Name: NF4255_low_14
Description: NF4255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4255_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 239
Target Start/End: Complemental strand, 52649344 - 52649110
Alignment:
| Q |
5 |
gtttttattagctgattatgatggcccaatttgctttataactctataaggttatttcacttatggaatccaccccatcttcgtttccctgtagcaagtc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52649344 |
gtttttattagctgattatgatggcccaatttgctttataactctataaggtaatttcacttatggaatccaccccatcttcgtttccctgtagcaagtc |
52649245 |
T |
 |
| Q |
105 |
aagtgcaacatcatgtctttgaattgaacacccaaaaacctgcattctactactgcatattgacactccgagcatgtgaatcatattccctggtaaggat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52649244 |
aagtgcaacatcatgtctttgaattgaacacccaaaaacctgcattctactactgcatattgacactccgagcatgtgaatcatattccctggtaaggat |
52649145 |
T |
 |
| Q |
205 |
tgaatgtgcacattttgttgacttaaggaattcat |
239 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52649144 |
tgaatgtgcacattttgttgagttaaggaattcat |
52649110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University