View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4255_low_19 (Length: 218)
Name: NF4255_low_19
Description: NF4255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4255_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 67 - 198
Target Start/End: Complemental strand, 11181319 - 11181188
Alignment:
| Q |
67 |
tatattttaaaatgttttcaacttgtagaagacaaaagttaagatagaaccccttcnnnnnnnnntgaagattgggaagatataaagataaacacaggta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11181319 |
tatattttaaaatgttttcaacttgtagaagacaaaagttaagatagaaccccttcaaaaaaaaatgaagattgggaagatataaagataaacataggta |
11181220 |
T |
|
| Q |
167 |
gtgtcacgggtttatacatgttcaaaatagac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11181219 |
gtgtcacgggtttatacatgttcaaaatagac |
11181188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 11178149 - 11178212
Alignment:
| Q |
16 |
caaaacctgtatcttaattactcctattaaataaattgtctcatattggtatatattttaaaat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11178149 |
caaaacctgtatcttaattactcctattaaataaattgtctcatattggtatatagtttaaaat |
11178212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University