View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4255_low_20 (Length: 206)

Name: NF4255_low_20
Description: NF4255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4255_low_20
NF4255_low_20
[»] chr5 (2 HSPs)
chr5 (1-66)||(40069592-40069657)
chr5 (148-182)||(40069737-40069771)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 40069592 - 40069657
Alignment:
1 ctaaagcttcaactaataataatagtaaccacatatacctaagttgattttacgtaataaatagat 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40069592 ctaaagcttcaactaataataatagtaaccacatatacctaagttgattttacgtaataaatagat 40069657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 148 - 182
Target Start/End: Original strand, 40069737 - 40069771
Alignment:
148 ccgacaacaaaactttgtacttaacgcttatgtac 182  Q
    |||||||||||||||||||||||||||||||||||    
40069737 ccgacaacaaaactttgtacttaacgcttatgtac 40069771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University