View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256-Insertion-10 (Length: 142)
Name: NF4256-Insertion-10
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 41627712 - 41627850
Alignment:
| Q |
1 |
ttccgataggtttcgtgagtaaaataatataccaccgggcgctaacaggaggccggatgaactgcactagaaagagataggacgagctcaaaaccataaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41627712 |
ttccgataggttttgtgagtaaaata---taccaccgggcgctaacaggaggccggatgaactgcactagaaagagataggacgagctcaaaaccataaa |
41627808 |
T |
|
| Q |
101 |
tggcaaacatagagacaatgtgaccaatcgtccaatccattg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41627809 |
tggcaaacatagagacaatgtgaccaatcgtccaatccattg |
41627850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University