View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256-Insertion-14 (Length: 84)
Name: NF4256-Insertion-14
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256-Insertion-14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 30; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 1248595 - 1248628
Alignment:
| Q |
1 |
ttaagattattagatatatgtatgtaggagaaga |
34 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
1248595 |
ttaagattattagatatatgtatgtaggaaaaga |
1248628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 47 - 79
Target Start/End: Original strand, 1244305 - 1244337
Alignment:
| Q |
47 |
attaagattctgtattataattagttgtttttt |
79 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
1244305 |
attaagagtctgtattataattagttgtttttt |
1244337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University