View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256-Insertion-3 (Length: 188)
Name: NF4256-Insertion-3
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 5 - 188
Target Start/End: Original strand, 55493704 - 55493887
Alignment:
| Q |
5 |
ccggcaccagcatcgcagacgattgcccgaacagattcgggaacagctttgcaatttcatctgcagaaacgataaaatcgaataattaaagggaattcga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55493704 |
ccggcaccagcatcgcagacgattgcccgaacagattcgggaacagctttgcaatttcatctgcagaaacgataaaatcgaataattaaagggaattcga |
55493803 |
T |
|
| Q |
105 |
gaatttgacgagaaattgagaattgtggacgagagaaaaggtgaaaaccggggttgccggcggcggagcttggaggaccatcga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55493804 |
gaatttgacgagaaattgagaattgtggacgagagaaaaggtgaaaaccggggttgccggcggcggagcttggaggaccatcga |
55493887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University