View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256-Insertion-7 (Length: 103)
Name: NF4256-Insertion-7
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256-Insertion-7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] scaffold0128 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 22472588 - 22472673
Alignment:
| Q |
19 |
tattcaatatgtatcgatttgaaaa-acattatatgctaaaaatatacttagataatcacagtatcacacaattgaaagttgaata |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22472588 |
tattcaatatgtatcgatttgaaaaaacattatatgctaaaaatatacatagataatcacagtatcacacaattgaaagttgaata |
22472673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 78
Target Start/End: Complemental strand, 9118 - 9061
Alignment:
| Q |
22 |
tcaatatgtatcgatttgaaaaa-cattatatgctaaaaatatacttagataatcaca |
78 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
9118 |
tcaatatgtatcgatttgaaaaaacattatatgctaacaatatacatagataatcaca |
9061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University