View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256-Insertion-8 (Length: 139)
Name: NF4256-Insertion-8
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256-Insertion-8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 1e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 8955886 - 8955756
Alignment:
| Q |
1 |
ctttatgcatggttcactttacatagaggaagattataaaaatgcattgtttgctataatatacgttgaaattgatttcactagtcactgtcgatgcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8955886 |
ctttatgcatggttcactttacatagaggaagattataaaaatgcattgtttgctataatataagttgaaattgatttcactagtcactgtcgatgtgtt |
8955787 |
T |
|
| Q |
101 |
agggcttgttttgaatttggagtgtgaaaga |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8955786 |
agggcttgttttgaatttggagtgtgaaaga |
8955756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 8964499 - 8964640
Alignment:
| Q |
1 |
ctttatgcatggttcactttacatagaggaagattataaaaatgcattgtttgctataatatacgttgaaattgatttcactagtcactgtcgatg---- |
96 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8964499 |
ctttatgcatggttcactttatatagaggaagattataaaaatgcattgtttgctataatatacgttgaaattgatttcactagtcactgtcgatgcgtt |
8964598 |
T |
|
| Q |
97 |
---cgttagggcttgttttgaatttggagtgtgaaagagttt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8964599 |
agccgttagggcttgttttgaatttggagtgtgaaagagttt |
8964640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University