View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256-Insertion-9 (Length: 139)
Name: NF4256-Insertion-9
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 16401865 - 16402003
Alignment:
| Q |
1 |
gctgataatgcatatttatgtagaaaatgtgacaatttagttcatcaagccaattttttggcacttagacatgtacggtgttttttgtgcaacacttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16401865 |
gctgataatgcatatttatgtagaaaatgtgacaatttggttcacaaagccaattttttggcacttagacatgtacggtgttttttgtgcaacacttgtc |
16401964 |
T |
|
| Q |
101 |
aaaatcttactagaagatgtctcattggagcttcactag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16401965 |
aaaatcttactagaagatgtctcattggagcttcactag |
16402003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 37507405 - 37507275
Alignment:
| Q |
1 |
gctgataatgcatatttatgtagaaaatgtgacaatttagttcatcaagccaattttttggcacttagacatgtacggtgttttttgtgcaacacttgtc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| |||| |||||||| || || || ||| | |||| ||| | |||||||| |||| |
|
|
| T |
37507405 |
gctgatgatgcatatttatgtagaaaatgtgacaaaaaggttcatgaagcaaattttttagccctaaggcatattaggtgctttctttgcaacacatgtc |
37507306 |
T |
|
| Q |
101 |
aaaatcttactagaagatgtctcattggagc |
131 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||| |
|
|
| T |
37507305 |
aaaatcttacaagaagatatcttattggagc |
37507275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University