View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256_high_18 (Length: 298)
Name: NF4256_high_18
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 54268143 - 54268442
Alignment:
| Q |
1 |
cctcctctactgttaatagttgatatgtccctaaattcagcatttgtagcagctcctgagaatgcaatcagatcatgagcagcaccatcca--------- |
91 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54268143 |
cctcctctactgttaataattgatatgtccctaaattcagcatttgtagcagctcctgagaatgcaatcagatcatgagcagcaccatccatctccatct |
54268242 |
T |
 |
| Q |
92 |
---tctccatctccacagggaataaagagttttcataattattattattgtcaataatccatcttaggttaagagcatcatctattgatttttgctgatc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
54268243 |
ccatctccatctccacagggaataaagagttttcataattattattattgtcaataatccatcttatgttaagagcatcatctattgatttctgctgatc |
54268342 |
T |
 |
| Q |
189 |
atagaaagtagcttctgtttttggaatggtctgcttcatggtgtaattttgttgtgacttgaagagtagttctgaagatggactattattgttgtctctg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54268343 |
atagaaagtagcttctgtttttggaatggtctgcttcatggtgtaattttgttgtgacttgaagagtagttctgaagatggactattattgttgtttctg |
54268442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University