View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256_low_22 (Length: 267)
Name: NF4256_low_22
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 35344710 - 35344549
Alignment:
| Q |
17 |
accttctttgtaacatttctgagtctgagatagtgttatagctctgcaaacattacaaataaagaagaataacgtacgaaaagnnnnnnnnnntagtttc |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35344710 |
accttctttgtaacgtttctgagtctgagatagtgttatagctctgcaaacattacaaataaagaagaataacgtacgaaaag-gaaaaaaaatagtttc |
35344612 |
T |
 |
| Q |
117 |
tatacaaaaacggcaagttcacattgctggtcaacatttttatttaaagggtcatgctaatat |
179 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35344611 |
tatacaaaaacggcaagttcacattactggtcaacatttttatttaaagggtcatgctaatat |
35344549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 35338469 - 35338409
Alignment:
| Q |
18 |
ccttctttgtaacatttctgagtctgagatagtgttatagctctgcaaacattacaaataa |
78 |
Q |
| |
|
|||||||||| || ||| ||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
35338469 |
ccttctttgtgacgtttttgagtatgagagagtgttattgctttgcaaacattacaaataa |
35338409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University