View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256_low_30 (Length: 236)
Name: NF4256_low_30
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 52600456 - 52600204
Alignment:
| Q |
1 |
cctaagattcccactaatgaactccatgaatcctgttatacatatagaaa------------------tttacaatgctatggtatatgtataatgtcaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52600456 |
cctaagattcccactaatgaactccatgaatcctgttatacatatagaaacttcaacacagattgatatttacaatgctatggtatatgtataatgtcaa |
52600357 |
T |
|
| Q |
83 |
atatacttcaactacctgactgttgattagttgggataatcctcttcatcacctcttctggtaaattgccaagcacaaataacagaaatatggttatttt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600356 |
atatacttcaactacctgactgttgattagttgggataatcctcttcatcacctcttctggtaaattgccaagcacaaataacagaaatatggttatttt |
52600257 |
T |
|
| Q |
183 |
tataagccgcgcaaccatgggcaaaattaaactaaattatatatgttgctatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600256 |
tataagccgcgcaaccatgggcaaaattaaactaaattatatatgttgctatt |
52600204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University