View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4256_low_31 (Length: 236)
Name: NF4256_low_31
Description: NF4256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4256_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 62 - 222
Target Start/End: Complemental strand, 9364194 - 9364034
Alignment:
| Q |
62 |
gtgaccaacttaaactttcttataagacgcaaggagttattagctagactagataatcaatataagatagaaatattaaagnnnnnnnnatagccttgta |
161 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9364194 |
gtgaccaacttagactttctcataagacgcaaggaattattagctggactagataatcaatataagatagaaatattaaagttttttctatagccttgta |
9364095 |
T |
|
| Q |
162 |
caatcaaagaatacagtgtctgggaggaggagtaatggaagtgcattgggaagtggcaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9364094 |
caatcaaagaatacagtgtctgggagaaggggtaatggaagtgcattgggaagtggcaaat |
9364034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 62 - 142
Target Start/End: Complemental strand, 9380433 - 9380353
Alignment:
| Q |
62 |
gtgaccaacttaaactttcttataagacgcaaggagttattagctagactagataatcaatataagatagaaatattaaag |
142 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9380433 |
gtgaccaacttaaactttctcataagacgcaaggagttattagctagactagataatcaatataagatagaaatattaaag |
9380353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University