View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4258-Insertion-1 (Length: 40)
Name: NF4258-Insertion-1
Description: NF4258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4258-Insertion-1 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 12102790 - 12102829
Alignment:
| Q |
1 |
gaaagtggattttatttctattattaatggcgagttatcc |
40 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12102790 |
gaaagtgggttttatttctattattaatggcgagttatcc |
12102829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 30203818 - 30203857
Alignment:
| Q |
1 |
gaaagtggattttatttctattattaatggcgagttatcc |
40 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30203818 |
gaaattgggttttatttctattattaatggcgagttatcc |
30203857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 17146724 - 17146762
Alignment:
| Q |
1 |
gaaagtggattttatttctattattaatggcgagttatc |
39 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
17146724 |
gaaagtgggttttatttctattattaatggtgagttatc |
17146762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University