View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4258-Insertion-4 (Length: 80)
Name: NF4258-Insertion-4
Description: NF4258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4258-Insertion-4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 3e-38
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 45361726 - 45361805
Alignment:
| Q |
1 |
gtgatgacatcaatggtgccactttacgtggctatgatattagcttatggttcagtgaaatggtggaagatattctctcc |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361726 |
gtgatgacatcaatggtgccactttacgtggctatgatattagcttatggttcagtgaaatggtggaagatattctctcc |
45361805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 74
Target Start/End: Original strand, 25038549 - 25038619
Alignment:
| Q |
4 |
atgacatcaatggtgccactttacgtggctatgatattagcttatggttcagtgaaatggtggaagatatt |
74 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||| ||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
25038549 |
atgacagcaatggtgccactttatgtagctatgatcttagcttatggatcagtaaaatggtggaaaatatt |
25038619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University