View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4258-Insertion-6 (Length: 86)
Name: NF4258-Insertion-6
Description: NF4258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4258-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 10441072 - 10440987
Alignment:
| Q |
1 |
taaaccttgtcacttggaggtacttgttgaccatcttttcttctcccctctgttccatagcatctaactgaaataacataccacaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441072 |
taaaccttgtcacttggaggtacttgttgaccatcttttcttctcccctctgttccatagcatctaactgaaataacataccacaa |
10440987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University