View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259-Insertion-15 (Length: 121)
Name: NF4259-Insertion-15
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259-Insertion-15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 5e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 4 - 58
Target Start/End: Complemental strand, 21307211 - 21307157
Alignment:
| Q |
4 |
gcttcaatttgctggaataatttagccataagaaatgggaaattcaaagttgttt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21307211 |
gcttcaatttgctggaataatttagccataagaaatgggaaattcaaagttgttt |
21307157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 4 - 58
Target Start/End: Complemental strand, 21315049 - 21314995
Alignment:
| Q |
4 |
gcttcaatttgctggaataatttagccataagaaatgggaaattcaaagttgttt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21315049 |
gcttcaatttgctggaataatttagccataagaaatgggaaattcaaagttgttt |
21314995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University