View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259-Insertion-16 (Length: 119)
Name: NF4259-Insertion-16
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259-Insertion-16 |
 | |
|
| [»] chr1 (6 HSPs) |
| |
|
| [»] scaffold0312 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 1e-54; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 967329 - 967440
Alignment:
| Q |
8 |
cattccatctcaattagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattact |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
967329 |
cattccatctcaactagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattact |
967428 |
T |
|
| Q |
108 |
tttctcatggtg |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
967429 |
tttctcatggtg |
967440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 947345 - 947456
Alignment:
| Q |
8 |
cattccatctcaattagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattact |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
947345 |
cattccatctcaactagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattact |
947444 |
T |
|
| Q |
108 |
tttctcatggtg |
119 |
Q |
| |
|
||||| |||||| |
|
|
| T |
947445 |
tttcttatggtg |
947456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 959324 - 959435
Alignment:
| Q |
8 |
cattccatctcaattagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattact |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
959324 |
cattccatctcaactagaagtacttctcttgaatctttctctactagagtttcagcttcacttatccaacatggaatttcatctctttcacatcattact |
959423 |
T |
|
| Q |
108 |
tttctcatggtg |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
959424 |
tttctcatggtg |
959435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 52 - 119
Target Start/End: Original strand, 974000 - 974067
Alignment:
| Q |
52 |
tagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtg |
119 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| ||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
974000 |
tagagtttcagcttcatttatccaatatggattttcatcttgttcacatcattacttttttcatggtg |
974067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 52 - 119
Target Start/End: Complemental strand, 421023 - 420956
Alignment:
| Q |
52 |
tagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtg |
119 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||| |||| | |||||||||| |||||||| |
|
|
| T |
421023 |
tagagtttcagcttcactaatccaatatggattttcatcttgttcacaccattacttttttcatggtg |
420956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 53 - 119
Target Start/End: Original strand, 940959 - 941025
Alignment:
| Q |
53 |
agagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtg |
119 |
Q |
| |
|
||||||||||||||||| |||||| ||||| || ||||| ||||| |||||||||| |||||||||| |
|
|
| T |
940959 |
agagtttcagcttcactaatccaatatggagttccatctctttcacatcattacttctctcatggtg |
941025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0312 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 52 - 119
Target Start/End: Original strand, 9548 - 9615
Alignment:
| Q |
52 |
tagagtttcagcttcacttatccaacatggaatttcatctttttcatatcattacttttctcatggtg |
119 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||| |||| | |||||||||| |||||||| |
|
|
| T |
9548 |
tagagtttcagcttcactaatccaatatggattttcatcttgttcacaccattacttttttcatggtg |
9615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University