View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259-Insertion-19 (Length: 135)
Name: NF4259-Insertion-19
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259-Insertion-19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 10506684 - 10506561
Alignment:
| Q |
11 |
ggctattggcaattctatgcacaataatagccacaggagttgtaattggaggtgtagtagtctttattggttacatagtaattcatccaagagtccctac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10506684 |
ggctattggcaattctatgcacaataatagccataggagttgtaattggaggtgtagtagtctttattggttacatagtaattcatccaagagtccctac |
10506585 |
T |
|
| Q |
111 |
aataagcatagcaaatgctcattt |
134 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10506584 |
aataagcatagcaaatgctcattt |
10506561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University