View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259-Insertion-2 (Length: 248)
Name: NF4259-Insertion-2
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 32040876 - 32040630
Alignment:
| Q |
1 |
gaaaggtggacttggctttccattagcaacaagacgttgcacgaagcttccaattctatttccgttagtctccgtcaataaccgtttccctccaaacggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32040876 |
gaaaggtggacttggctttccattagcaacaagacgttgcacgaagcttccgattctatttccgttagtctccgtcaataaccgtttccctccaaacggt |
32040777 |
T |
|
| Q |
101 |
aacgactccaatcctctttccttcaacacttcctcttcacttcccaaaccaaacgcctgttacaaaataaacgccgttaactaacggtaactgggataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
32040776 |
aacgactccaatcctctttccttcaacacttcctcttcacttcccaaaccaaacgcctgttacaaaacaaacgccgttaactaacggtaact-ggataat |
32040678 |
T |
|
| Q |
201 |
gatgtgatttgattgatttctattttctgagttctgaacgaaatgcag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32040677 |
gatgtgatttgattgatttctattttctgagttctgaacgaaatgcag |
32040630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 107
Target Start/End: Original strand, 37935892 - 37935983
Alignment:
| Q |
16 |
ctttccattagcaacaagacgttgcacgaagcttccaattctatttccgttagtctccgtcaataaccgtttccctccaaacggtaacgact |
107 |
Q |
| |
|
||||||| |||||||||| |||||||| || || ||||||| || |||||||| || | |||||||||||| |||||||||||||||| |
|
|
| T |
37935892 |
ctttccagtagcaacaagtcgttgcacaaacctctcaattctgttgccgttagtttcttgtagtaaccgtttcccaccaaacggtaacgact |
37935983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University