View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259-Insertion-4 (Length: 180)
Name: NF4259-Insertion-4
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 21435261 - 21435075
Alignment:
| Q |
1 |
acaagtagatgatgtcatagagagagaaataaaatgagttttttaaccgagtgttgagagtatgagtacat-------tcattgttgaattaataattta |
93 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
21435261 |
acaagtagatgatgtgatagagagagaaataaaatgagttttttaaccgagtgttaagagtatgagtacatgcatgtatcatcgttgaattaataattta |
21435162 |
T |
 |
| Q |
94 |
taatttccctatactaatgaaaacttttaatggagaaagagtttcctaaatatcaatgcaagggcttacaatatatagatgaataga |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21435161 |
taatttccctatactaaggaaaacttttaatggagaaagagtttcctaaatatcaatgcaagggcttacaatatataggtgaataga |
21435075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University