View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259_high_26 (Length: 239)
Name: NF4259_high_26
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 47453992 - 47453812
Alignment:
| Q |
1 |
aacttaaggggaagctagagcaattctctataagtgagggaaatcatcaccgtaggtgtcgtgttagggccaaccacaaattctaggaactataaatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47453992 |
aacttaaggggaagctagagcaattctcaataagtgagggaaatcatcacggtaggtgttgtgttagggccaaccacaaattctaggaactataaatgag |
47453893 |
T |
|
| Q |
101 |
ttacaagtttgaagtcagagtgtcatgtatgaactagtccaattagattatcattagtaaagttgttactcccagcgccat |
181 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47453892 |
ttagaagtttgaagtcaaagtgtcatgtatgaactagtccaattagattatcattagtaaagttgttactcccagcgccat |
47453812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University