View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259_low_29 (Length: 238)
Name: NF4259_low_29
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 55 - 222
Target Start/End: Original strand, 4092527 - 4092694
Alignment:
| Q |
55 |
gaggaaaagatagtactgctttatacgatggtttatctaaccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092527 |
gaggaaaagatagtactgctttatacgatggtttatctagccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt |
4092626 |
T |
|
| Q |
155 |
gcactgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataatt |
222 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092627 |
gcaccgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataatt |
4092694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 55 - 222
Target Start/End: Original strand, 4082834 - 4083001
Alignment:
| Q |
55 |
gaggaaaagatagtactgctttatacgatggtttatctaaccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
4082834 |
gaggaaaagatagtactgctttatatgatggtttatctagccttgccgaatttcattttttgacaaaaggataaggatggaatgatgattggttaaaagt |
4082933 |
T |
|
| Q |
155 |
gcactgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4082934 |
acactgtgtcatgtttgcatttttcaagggttggtgaaattattttgtcccaaagatatcatataatt |
4083001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 41
Target Start/End: Original strand, 4082783 - 4082818
Alignment:
| Q |
6 |
ggaaaaggtgggatggtggtagtggagtgaatttga |
41 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4082783 |
ggaaaaggtgggatggtggtggtggagtgaatttga |
4082818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University