View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4259_low_29 (Length: 238)

Name: NF4259_low_29
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4259_low_29
NF4259_low_29
[»] chr8 (3 HSPs)
chr8 (55-222)||(4092527-4092694)
chr8 (55-222)||(4082834-4083001)
chr8 (6-41)||(4082783-4082818)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 55 - 222
Target Start/End: Original strand, 4092527 - 4092694
Alignment:
55 gaggaaaagatagtactgctttatacgatggtttatctaaccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt 154  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4092527 gaggaaaagatagtactgctttatacgatggtttatctagccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt 4092626  T
155 gcactgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataatt 222  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4092627 gcaccgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataatt 4092694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 55 - 222
Target Start/End: Original strand, 4082834 - 4083001
Alignment:
55 gaggaaaagatagtactgctttatacgatggtttatctaaccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt 154  Q
    ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||    
4082834 gaggaaaagatagtactgctttatatgatggtttatctagccttgccgaatttcattttttgacaaaaggataaggatggaatgatgattggttaaaagt 4082933  T
155 gcactgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataatt 222  Q
     |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
4082934 acactgtgtcatgtttgcatttttcaagggttggtgaaattattttgtcccaaagatatcatataatt 4083001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 41
Target Start/End: Original strand, 4082783 - 4082818
Alignment:
6 ggaaaaggtgggatggtggtagtggagtgaatttga 41  Q
    |||||||||||||||||||| |||||||||||||||    
4082783 ggaaaaggtgggatggtggtggtggagtgaatttga 4082818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University