View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4259_low_32 (Length: 233)

Name: NF4259_low_32
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4259_low_32
NF4259_low_32
[»] chr6 (2 HSPs)
chr6 (145-205)||(2047118-2047178)
chr6 (13-85)||(2053448-2053519)


Alignment Details
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 145 - 205
Target Start/End: Original strand, 2047118 - 2047178
Alignment:
145 gattttaatttagttcaatattgttacttagatcttaattagtttcttatctctgttactt 205  Q
    |||| |||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||    
2047118 gattctaatttagttcattattgttacttagatgttaatttgtttcttatctctgttactt 2047178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 2053448 - 2053519
Alignment:
13 taaggtgaattacttccaaaaagcatattaaaatnnnnnnnntgttgtctcagaatgaacttaaaaaatgtta 85  Q
    |||||||||||||||||||||||||||| |||||        ||||||||||||||||| |||||||||||||    
2053448 taaggtgaattacttccaaaaagcatatcaaaat-aaaaaaatgttgtctcagaatgaatttaaaaaatgtta 2053519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University