View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4259_low_32 (Length: 233)
Name: NF4259_low_32
Description: NF4259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4259_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 145 - 205
Target Start/End: Original strand, 2047118 - 2047178
Alignment:
| Q |
145 |
gattttaatttagttcaatattgttacttagatcttaattagtttcttatctctgttactt |
205 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
2047118 |
gattctaatttagttcattattgttacttagatgttaatttgtttcttatctctgttactt |
2047178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 2053448 - 2053519
Alignment:
| Q |
13 |
taaggtgaattacttccaaaaagcatattaaaatnnnnnnnntgttgtctcagaatgaacttaaaaaatgtta |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
2053448 |
taaggtgaattacttccaaaaagcatatcaaaat-aaaaaaatgttgtctcagaatgaatttaaaaaatgtta |
2053519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University