View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4260-Insertion-1 (Length: 120)
Name: NF4260-Insertion-1
Description: NF4260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4260-Insertion-1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 42665645 - 42665525
Alignment:
| Q |
1 |
attcaaagattaaaatacatggtttggttggacttgtgttagatgactcctttaaaaaatatggtt-taccaaatgtgatttagtctgtaccaattttcg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| ||||||||| |
|
|
| T |
42665645 |
attcaaagattaaaatacatggtttggttggacttgtgttagatgactcctttaaaaaatatggttcaactaaatgtgatttagtttgtatcaattttcg |
42665546 |
T |
 |
| Q |
100 |
tttgacttaaattctaagatg |
120 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
42665545 |
tttgacctaaattctaagatg |
42665525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University