View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4260-Insertion-4 (Length: 58)
Name: NF4260-Insertion-4
Description: NF4260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4260-Insertion-4 |
 |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 4e-21; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 4 - 58
Target Start/End: Complemental strand, 14455826 - 14455772
Alignment:
| Q |
4 |
gaattaaaccagcaaagccagcagttgagaggttcagatattgcaaattcaccaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14455826 |
gaattaaaccagcaaagccagcagttgacaggttcagatattgcaaattcaccaa |
14455772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 4 - 58
Target Start/End: Original strand, 14495524 - 14495578
Alignment:
| Q |
4 |
gaattaaaccagcaaagccagcagttgagaggttcagatattgcaaattcaccaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14495524 |
gaattaaaccagcaaagccagcagttgacaggttcagatattgcaaattcaccaa |
14495578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 14460308 - 14460271
Alignment:
| Q |
21 |
ccagcagttgagaggttcagatattgcaaattcaccaa |
58 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14460308 |
ccagcagttgacaggttcagatattgcaaattcaccaa |
14460271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 4 - 52
Target Start/End: Original strand, 14471103 - 14471151
Alignment:
| Q |
4 |
gaattaaaccagcaaagccagcagttgagaggttcagatattgcaaatt |
52 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||||||||| ||||| |
|
|
| T |
14471103 |
gaattaaaccagcaaatccagcatttgaaaggttcagatattgtaaatt |
14471151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 34; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 9887 - 9850
Alignment:
| Q |
21 |
ccagcagttgagaggttcagatattgcaaattcaccaa |
58 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9887 |
ccagcagttgacaggttcagatattgcaaattcaccaa |
9850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University