View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4260_high_8 (Length: 230)
Name: NF4260_high_8
Description: NF4260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4260_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 76 - 197
Target Start/End: Complemental strand, 21748377 - 21748256
Alignment:
| Q |
76 |
tctataaattcatagttaaagagtgcctttgccttgttctatcattagaaaatcatagtcaaagacacattacaagcaccatgttgtagcaaattctact |
175 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21748377 |
tctataaattcatagttaaagagtgtctttgccttgttctatcattagaaaatcatagtcaaagacacattacaagcaccatgttgtagcacattctact |
21748278 |
T |
 |
| Q |
176 |
aaaactagtactatggatagca |
197 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
21748277 |
aaaactagtactatcgatagca |
21748256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University