View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4260_high_9 (Length: 217)

Name: NF4260_high_9
Description: NF4260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4260_high_9
NF4260_high_9
[»] chr6 (1 HSPs)
chr6 (17-200)||(26303179-26303362)


Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 26303362 - 26303179
Alignment:
17 atttccaacagtaaagttcaataagaaatgttgactaaaataataattgtgatgaacaatatattttggctgctccacttcactcaagcaatatgatcca 116  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26303362 atttccaacagtaaagttcaataagaaatgttcactaaaataataattgtgatgaacaatatattttggctgctccacttcactcaagcaatatgatcca 26303263  T
117 tgcatgtgtggcatgactgctactgccacagtgtcagcaggacgatggatgctatactttgatgattcatttgccaaaagatct 200  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||    
26303262 tgcatgtgtggcatgactgctactgccacagtgtcagcaagacgatggatgctatactttgatgattcatttgacaaaagatct 26303179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University