View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4260_low_7 (Length: 247)
Name: NF4260_low_7
Description: NF4260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4260_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 641961 - 641751
Alignment:
| Q |
19 |
attcgcgctataaatgtttgtcagagggagattttaggaatggaggaggaaaacaagaacttaacagaaacaaggattcaacaattatctcagtgtctaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641961 |
attcgcgctataaatgtttgtcagagggagattttaggaatggaggaggaaaacaagaacttaacagaaacaaggattcaacaattatctcagtgtctaa |
641862 |
T |
|
| Q |
119 |
accaaaacacgaatatctgttcgaattcaaattcaaaactaaatggattcagtggtttcagaggtgttctttttgcaatgaggagtgttagttcattact |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641861 |
accaaaacacgaacatctgttcgaattcaaattcaaaactaaatggattcagtggtttcagaggtgttctttttgcaatgaggagtgttagttcattact |
641762 |
T |
|
| Q |
219 |
tctgatgattc |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
641761 |
tctgatgattc |
641751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University