View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4261_high_15 (Length: 210)
Name: NF4261_high_15
Description: NF4261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4261_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 44567270 - 44567099
Alignment:
| Q |
17 |
caaaggtagatgcaaatgcaacaacagaatgataatagatacttaccaaatagagataatactatgagaagacacgcacccaattgaactggtctgcggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567270 |
caaaggtagatgcaaatgcaacaacagaatgataatagatacttaccaaatagagataatactatgagaagacacgcacccaattgaactggtctgcggc |
44567171 |
T |
 |
| Q |
117 |
ttcccatttttgtcccagcaattgtgtgaacattttcggttagagttgttgatcccattccagtaccccaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567170 |
ttcccatttttgtcccagcaattgtgtgaacattttcggttagagttgttgatcccattccagtaccccaga |
44567099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 47 - 188
Target Start/End: Original strand, 36031503 - 36031644
Alignment:
| Q |
47 |
gataatagatacttaccaaatagagataatactatgagaagacacgcacccaattgaactggtctgcggcttcccatttttgtcccagcaattgtgtgaa |
146 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||| |||| ||| |||||||||||||||| |||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
36031503 |
gataatagatacttacccacgagagataacactatcagaatacatgcacccaattgaactgctctgcggcttcccattttagtcacagcaattgtatgaa |
36031602 |
T |
 |
| Q |
147 |
cattttcggttagagttgttgatcccattccagtaccccaga |
188 |
Q |
| |
|
||||||| |||| ||| || ||||| ||||||||||||||| |
|
|
| T |
36031603 |
cattttcagttaaagtggtagatccagttccagtaccccaga |
36031644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 106
Target Start/End: Original strand, 16069361 - 16069436
Alignment:
| Q |
31 |
aatgcaacaacagaatgataatagatacttaccaaatagagataatactatgagaagacacgcacccaattgaact |
106 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| |||| |||||||||||| | |||||||| ||||| ||||||||| |
|
|
| T |
16069361 |
aatgaaacaacaaaatgataatagatacttagcaaagagagataatactgtcagaagacatgcacctaattgaact |
16069436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 113 - 188
Target Start/End: Complemental strand, 20124273 - 20124198
Alignment:
| Q |
113 |
cggcttcccatttttgtcccagcaattgtgtgaacattttcggttagagttgttgatcccattccagtaccccaga |
188 |
Q |
| |
|
|||||||||||||| ||| | |||||||| |||||||||||||||| |||||| ||||| ||||||| ||||||| |
|
|
| T |
20124273 |
cggcttcccattttagtcacggcaattgtatgaacattttcggttaaagttgtagatccagttccagttccccaga |
20124198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University