View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4261_low_15 (Length: 241)
Name: NF4261_low_15
Description: NF4261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4261_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 7336782 - 7336552
Alignment:
| Q |
6 |
actttgttgtgaacttgaaaatgttttgttcttgatttggaacaataattcaacttctcttgacacatcaagtagttgtttgcattgtgctttccttctt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336782 |
actttgttgtgaacttgaaaatgttttgttcttgatttggaacaataattcaacttctcttgacacatcaagtagttgtttgcattgtgctttccttctt |
7336683 |
T |
 |
| Q |
106 |
ttcatatgtggtttagtttttcttggtgcaagtggacattgctttggtatttggattctattatcaaaatgagttggagttttgaatccatcatcttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336682 |
ttcatatgtggtttagtttttcttggtgcaagtggacattgctttggtatttggattctattatcaaaatgagttggagttttgaatccatcatcttcat |
7336583 |
T |
 |
| Q |
206 |
cttcttcattttccaattctcttgatgatgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7336582 |
cttcttcattttccaattctcttgatgatgt |
7336552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University