View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4261_low_16 (Length: 241)
Name: NF4261_low_16
Description: NF4261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4261_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 233
Target Start/End: Original strand, 30943392 - 30943618
Alignment:
| Q |
7 |
cttcaaaacctcttatccattttcttcccctttttaccttaacttccataacaaccaaaacactaccattctgttatccagatggatctattgctccatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943392 |
cttcaaaacctcttatccattttcttcccctttttaccttaacttccataacaaccaaaacactaccattctgttatccagatggatctattgctccatc |
30943491 |
T |
 |
| Q |
107 |
ctcacactgttctctttacaaaagcatgttttttcttttatcactatatcattagccgtaatatcacggcctaaattgcagttgcaaaccttgatttatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30943492 |
ctcacactgttctctttacaaaagcatgttttttcttttatcactatatcattacccgtaatatcacggcctaaatcgcagttgcaaaccttgatttatt |
30943591 |
T |
 |
| Q |
207 |
taaaatcctgctctttagtttttagtt |
233 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30943592 |
taaaatcctgctctttagtttttagtt |
30943618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University