View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4262_low_5 (Length: 229)
Name: NF4262_low_5
Description: NF4262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4262_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 125 - 177
Target Start/End: Original strand, 34585315 - 34585367
Alignment:
| Q |
125 |
ttgttactttggttcatctgagcgagcagtagcatacccttacttattttaaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34585315 |
ttgttactttggttcatctgagcgagcagtagcataccgttacttattttaaa |
34585367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 17 - 72
Target Start/End: Original strand, 34585268 - 34585320
Alignment:
| Q |
17 |
tagggtgtactagcatgtttcttcaaattatttgattaataatcttgaaattgtta |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34585268 |
tagggtgtactagcatgtttcttcaaattatttgat---taatcttgaaattgtta |
34585320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 86 - 125
Target Start/End: Original strand, 34585305 - 34585344
Alignment:
| Q |
86 |
aatcttgaaattgttacttaggttcatctgagcgagcagt |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34585305 |
aatcttgaaattgttactttggttcatctgagcgagcagt |
34585344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University