View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263-Insertion-11 (Length: 98)
Name: NF4263-Insertion-11
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263-Insertion-11 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 7e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 7e-46
Query Start/End: Original strand, 6 - 98
Target Start/End: Original strand, 29621518 - 29621610
Alignment:
| Q |
6 |
gttgcaactagtcgctttcagttatgttttttgtattaaatttacaatgcttgcagggtgaacttgaggttgttaaagtgattcctaacaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29621518 |
gttgcaactagtcgctttcagttatgttttttgtattaaatttacaatgcttgcagggtgaacttgaggttgttaaagtgattcctaacaaaa |
29621610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 29660923 - 29660994
Alignment:
| Q |
27 |
ttatgttttttgtattaaatttacaatgcttgcagggtgaacttgaggttgttaaagtgattcctaacaaaa |
98 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29660923 |
ttatgttttatgtattaaatttactgtgcttgcagggtgaacttgaggttgttaaagatattcctaacaaaa |
29660994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University