View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263-Insertion-16 (Length: 80)
Name: NF4263-Insertion-16
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263-Insertion-16 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 8e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 8e-36
Query Start/End: Original strand, 5 - 80
Target Start/End: Complemental strand, 48536399 - 48536324
Alignment:
| Q |
5 |
taatatcttttgtaccaatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536399 |
taatatcttttgtaccaatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacat |
48536324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University