View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4263-Insertion-17 (Length: 72)

Name: NF4263-Insertion-17
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4263-Insertion-17
NF4263-Insertion-17
[»] chr6 (3 HSPs)
chr6 (2-72)||(30935366-30935436)
chr6 (2-72)||(30994275-30994345)
chr6 (26-69)||(30965503-30965546)


Alignment Details
Target: chr6 (Bit Score: 67; Significance: 2e-30; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 30935366 - 30935436
Alignment:
2 agatttgccacttcaatttattctgctttggaaatatatcagaagtgctagtgaagcagcagcacatacag 72  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
30935366 agatttgccacttcaatttattctgctttggaaatatgtcagaagtgctagtgaagcagcagcacatacag 30935436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 30994275 - 30994345
Alignment:
2 agatttgccacttcaatttattctgctttggaaatatatcagaagtgctagtgaagcagcagcacatacag 72  Q
    |||||||||| ||||||||| |||||||||||||| | ||||| ||||||||||||||||| |||||||||    
30994275 agatttgccaattcaatttactctgctttggaaatgtttcagatgtgctagtgaagcagcaacacatacag 30994345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 30965503 - 30965546
Alignment:
26 gctttggaaatatatcagaagtgctagtgaagcagcagcacata 69  Q
    ||||||||||| | ||||||||||||||||||||||||||||||    
30965503 gctttggaaatgtttcagaagtgctagtgaagcagcagcacata 30965546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University