View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263-Insertion-17 (Length: 72)
Name: NF4263-Insertion-17
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263-Insertion-17 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 2e-30; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 30935366 - 30935436
Alignment:
| Q |
2 |
agatttgccacttcaatttattctgctttggaaatatatcagaagtgctagtgaagcagcagcacatacag |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30935366 |
agatttgccacttcaatttattctgctttggaaatatgtcagaagtgctagtgaagcagcagcacatacag |
30935436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 2 - 72
Target Start/End: Original strand, 30994275 - 30994345
Alignment:
| Q |
2 |
agatttgccacttcaatttattctgctttggaaatatatcagaagtgctagtgaagcagcagcacatacag |
72 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| | ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
30994275 |
agatttgccaattcaatttactctgctttggaaatgtttcagatgtgctagtgaagcagcaacacatacag |
30994345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 30965503 - 30965546
Alignment:
| Q |
26 |
gctttggaaatatatcagaagtgctagtgaagcagcagcacata |
69 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
30965503 |
gctttggaaatgtttcagaagtgctagtgaagcagcagcacata |
30965546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University