View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263-Insertion-5 (Length: 93)
Name: NF4263-Insertion-5
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263-Insertion-5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 1e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 27548504 - 27548416
Alignment:
| Q |
1 |
tatagtccatgactgtgtatcttttctactctctaacttttgtctactgaaattttagatatatacctgtaactctaaatttccaaaat |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27548504 |
tatagtccatgactgtgtatcttttctactctctaacttttgtctactcaaattttagatatatacctctaactctaaatttccaaaat |
27548416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 63
Target Start/End: Original strand, 27437895 - 27437953
Alignment:
| Q |
3 |
tagtccatgactgtgtatcttttctactctctaacttttgtctactgaaattttagatata |
63 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
27437895 |
tagtccatgactgt--atcttttctactctctaagttttgtttactgaaattttagatata |
27437953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 27946256 - 27946316
Alignment:
| Q |
1 |
tatagtccatgactgtgtatcttttctactctctaacttttgtctactgaaattttagatata |
63 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
27946256 |
tatagtccatgactgt--atcttttctactttctatgttttgtttactgaaattttagatata |
27946316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University