View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4263-Insertion-5 (Length: 93)

Name: NF4263-Insertion-5
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4263-Insertion-5
NF4263-Insertion-5
[»] chr4 (3 HSPs)
chr4 (1-89)||(27548416-27548504)
chr4 (3-63)||(27437895-27437953)
chr4 (1-63)||(27946256-27946316)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 1e-38; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 27548504 - 27548416
Alignment:
1 tatagtccatgactgtgtatcttttctactctctaacttttgtctactgaaattttagatatatacctgtaactctaaatttccaaaat 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||    
27548504 tatagtccatgactgtgtatcttttctactctctaacttttgtctactcaaattttagatatatacctctaactctaaatttccaaaat 27548416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 63
Target Start/End: Original strand, 27437895 - 27437953
Alignment:
3 tagtccatgactgtgtatcttttctactctctaacttttgtctactgaaattttagatata 63  Q
    ||||||||||||||  |||||||||||||||||| |||||| |||||||||||||||||||    
27437895 tagtccatgactgt--atcttttctactctctaagttttgtttactgaaattttagatata 27437953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 27946256 - 27946316
Alignment:
1 tatagtccatgactgtgtatcttttctactctctaacttttgtctactgaaattttagatata 63  Q
    ||||||||||||||||  |||||||||||| ||||  |||||| |||||||||||||||||||    
27946256 tatagtccatgactgt--atcttttctactttctatgttttgtttactgaaattttagatata 27946316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University