View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263_high_10 (Length: 303)
Name: NF4263_high_10
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 32378128 - 32377924
Alignment:
| Q |
1 |
cagaaattataaataaatttggttttgacactattgtcacggactcacacctaacaaaacttcctttaaatatatatattttttattgagttattccttt |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
32378128 |
cagaaattataaatcaatttggttttgacactattgtcacggactcacacctaacaaaacttcctttaaatattt---ttttttattgagttattccttt |
32378032 |
T |
 |
| Q |
101 |
gaagatttgaaaccatagaaaaattgcattgatcccaataccacttctttaccaaataacccgccaacattttttcccatgannnnnnngtgtccacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32378031 |
gaagatttgaaaccatagaaaaattgcattgatcccaataccacttctttaccaaataacccgccaacattttttcccatgatttttttgtgtccacata |
32377932 |
T |
 |
| Q |
201 |
aagaaacg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
32377931 |
aagaaacg |
32377924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University