View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263_high_22 (Length: 218)
Name: NF4263_high_22
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 82 - 199
Target Start/End: Original strand, 38613476 - 38613593
Alignment:
| Q |
82 |
taattcttactaaatatttcacagagctcctttgctttgccaacaaattcaggaacttcatatctgaaggtgccgttccatctccttctttgttctctac |
181 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38613476 |
taattcttactaaatattccacagagctcctttgctttgccaacaaattcaggaacttcatatctgaaggtgccgttccatctccttctttgttctctac |
38613575 |
T |
|
| Q |
182 |
ttttatttatttttctat |
199 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38613576 |
ttttatttatttttctat |
38613593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 38612146 - 38612218
Alignment:
| Q |
18 |
ttctggtgccgttattattggtgttatctcttgtatttttcctgtttagaaaatgatctgatgttaattctta |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38612146 |
ttctggtgccgttattattggtgttatctcttgtattttttctgtttagaaaatgatctgatgttaattctta |
38612218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University