View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263_high_8 (Length: 341)
Name: NF4263_high_8
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 14 - 333
Target Start/End: Original strand, 30172782 - 30173099
Alignment:
| Q |
14 |
ataagtgcttaattaaatttagtttataatcgagttttctgtactgcagaccactcttctgaatcatattctcacatcccaacatggcaagcggatagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30172782 |
ataagtgcttaattaaatttagtttataatcgagttttctgtactgcagaccactcttctgaatcatattctcacatcccaacatggcaagcggatagct |
30172881 |
T |
 |
| Q |
114 |
gtcattgaaaatgaggtatcgagtttgttttgtagagaaattgtaaaatgagggaagaatttgattgtcttattataatacggatttacagtttttcatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30172882 |
gtcattgaaaatgaggtatcgagtttgttttgtagataaattgtaaaatgagggaagaatttgattgtct--ttataatacggatttacagtttttcatg |
30172979 |
T |
 |
| Q |
214 |
aaattattttgttgtgaataatgcagtttggtgaggttgatattgatggatcactggttgctagccattcttctgtgaatggtgaagacattatcatggt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30172980 |
aaattattttgttgtgaataatgcagtttggtgaggttgatattgatggatcactggttgctagccattcttctgtgaatggtgaagacattatcatggt |
30173079 |
T |
 |
| Q |
314 |
caataatggctgcctatgct |
333 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30173080 |
caataatggctgcctatgct |
30173099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University