View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4263_low_24 (Length: 227)

Name: NF4263_low_24
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4263_low_24
NF4263_low_24
[»] chr7 (2 HSPs)
chr7 (7-102)||(44349786-44349881)
chr7 (164-215)||(44349911-44349962)


Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 7 - 102
Target Start/End: Original strand, 44349786 - 44349881
Alignment:
7 gttttattatctccagtacttcctctatttcattgttaatttttaatgtcttaatggtgttttagcttttcgatcatgctaacttttgctctaaga 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44349786 gttttattatctccagtacttcctctatttcattgttaatttttaatgtcttaatggtgttttagcttttcgatcatgctaacttttgctctaaga 44349881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 44349911 - 44349962
Alignment:
164 ttattaaccacgaattttttactagaaaatgtgacgacaggagaggagctac 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
44349911 ttattaaccacgaattttttactagaaaatgtgacgacaggagaggagctac 44349962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University