View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4263_low_24 (Length: 227)
Name: NF4263_low_24
Description: NF4263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4263_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 7 - 102
Target Start/End: Original strand, 44349786 - 44349881
Alignment:
| Q |
7 |
gttttattatctccagtacttcctctatttcattgttaatttttaatgtcttaatggtgttttagcttttcgatcatgctaacttttgctctaaga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44349786 |
gttttattatctccagtacttcctctatttcattgttaatttttaatgtcttaatggtgttttagcttttcgatcatgctaacttttgctctaaga |
44349881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 44349911 - 44349962
Alignment:
| Q |
164 |
ttattaaccacgaattttttactagaaaatgtgacgacaggagaggagctac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44349911 |
ttattaaccacgaattttttactagaaaatgtgacgacaggagaggagctac |
44349962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University