View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4264-Insertion-1 (Length: 270)
Name: NF4264-Insertion-1
Description: NF4264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4264-Insertion-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 28161816 - 28161547
Alignment:
| Q |
1 |
tttttccagtcaaaagctcgaggagaaggacaccaaagctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctata |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161816 |
ttttgccagtcaaaagctcgaggagaaggacaccaaagctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctata |
28161717 |
T |
|
| Q |
101 |
gaaaaaagaagtggcacttggttcctccattgtgtcgggattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161716 |
gaaaaaagaagtggcacttggttcctccattgtgtcgggattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaac |
28161617 |
T |
|
| Q |
201 |
acattggaagatttcagatttccgtgagccatgccggggttttggtggatatagagaaggcctgttgcta |
270 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161616 |
acattggaagatttcagatttccatgagccatgccggggttttggtggatatagagaaggcctgttgcta |
28161547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University