View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4264-Insertion-10 (Length: 75)
Name: NF4264-Insertion-10
Description: NF4264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4264-Insertion-10 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 42093282 - 42093356
Alignment:
| Q |
1 |
gcaggaactcaaaattgatagcataagaagtaacaaatagatagcacatcaaagactacttctgccaaagataat |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
42093282 |
gcaggaactcaaaattgatagcataagaagtaacaaatagatagcatatcaaagactacttctaccaaagataat |
42093356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 29707193 - 29707250
Alignment:
| Q |
1 |
gcaggaactcaaaattgatagcataagaagtaacaaatagatagcacatcaaagacta |
58 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| || ||| ||||||| |
|
|
| T |
29707193 |
gcaggaactcaaaattgatagcatatgaagtaacaaatagataacatatcgaagacta |
29707250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 5 - 75
Target Start/End: Original strand, 27509747 - 27509817
Alignment:
| Q |
5 |
gaactcaaaattgatagcataagaagtaacaaatagatagcacatcaaagactacttctgccaaagataat |
75 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
27509747 |
gaactcaaaattgatagcatatgaagtaacaaatagaaagcatatcaaagactactcataccaaagataat |
27509817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 27271664 - 27271628
Alignment:
| Q |
1 |
gcaggaactcaaaattgatagcataagaagtaacaaa |
37 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27271664 |
gcaggaactcaaaattgatagcatatgaagtaacaaa |
27271628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 39211196 - 39211138
Alignment:
| Q |
1 |
gcaggaactcaaaa-ttgatagcataagaagtaacaaatagatagcacatcaaagacta |
58 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
39211196 |
gcaggaactcaaaaattgatagcatatgaagtaacaaatagatagcatatcaaagacta |
39211138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University