View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4264-Insertion-3 (Length: 164)
Name: NF4264-Insertion-3
Description: NF4264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4264-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 3 - 164
Target Start/End: Complemental strand, 56298536 - 56298374
Alignment:
| Q |
3 |
attcaagataatgggaaataagacaacgtcttgatgctattacagacaatctaataaatttgtgaacaaatttcatataacattggtttaaaagttacaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56298536 |
attcaagataatgggaaataagacaacgtcttgatgcta--acagacaatctaataaatttgtgaacaaatttcatataacattggtttaaaagttacga |
56298439 |
T |
|
| Q |
103 |
atgtttttagtccctatataaaatacggctattgtat---taacattttcgataaaaatgtgtta |
164 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
56298438 |
atgtttttaatccctatataaaatacggctactgtattactaacattttcgataaaaatgtgtta |
56298374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University